¡Hola a [email protected]!

[email protected] al nuevo foro de coches.net. ¡Esperamos que os guste! :)

Si tenéis algún problema o sugerencia podéis comentarlo en este post

¿click Seguros 438 € Mutua MadrileÑa 1400€?

13»

Comentarios

  • AjperezAjperez Forero Senior ✭✭✭
    AfdA escribió :
    1º te explican lo que les interesa

    2º te explican como les interesa

    3º cuando tengas un problema vuelve al punto 1 y 2.

    Contratar con un profesional no quiere decir que te de la poliza a leer, eso lo puedes hacer tu con la de balumba (eso si, despues de que te han mandado el recibo y demas, y si, conozco lo relativo en la ley de compras a distancia, pero si en ese plazo te hanpasado algo...).

    Contratar con un profesional quiere decir que te va a explicar lo que debes saber, si le preguntas te contestara lo que te interesa a ti conocer, cuando tengas un problema te asesorara y te explicara lo que te interesa a ti conocer...

    Y normalmente no hay mucha diferencia de precio.

    image


    pues que yo recuerde si mal no recuerdo el que contrata una poliza lo hace con antelacion, y si te an cobrado el recibo y no estas de acuerdo con lo que lees en la poliza te recuerdo de que tines 15 en el banco para hecharla para atras
  • AfdAAfdA Forero Senior ✭✭✭
    Ajperez escribió :
    pues que yo recuerde si mal no recuerdo el que contrata una poliza lo hace con antelacion, y si te an cobrado el recibo y no estas de acuerdo con lo que lees en la poliza te recuerdo de que tines 15 en el banco para hecharla para atras

    No puedes devolver el recibo sin mas. Puedes anular la poliza al tratarse de contratacion a distancia. Pero ya la has contratado sin saber muy bien que. Y si en ese periodo te pasa algo...

    image
  • Anakin SkywalkerAnakin Skywalker Forero Senior ✭✭✭
    AfdA escribió :
    De acuerdo en el hecho de la oficina en si. Pero es que la diferencia no es esa.

    Unos ladrillos no te sirven, estamos de acuerdo.

    Pero lo que hay dentro si.

    En una compañia tradicional, con oficinas, sucursales y mediadores, las oficinas no estan vacias. Hay profesionales. Muchos. A los que las compañias les pagan (empleados) porque realizan un trabajo, que si no fuera imprescindible, te garantizo, no les pagarian.

    Sin embargo, la compañia sin oficinas lo que tiene es un call center lleno de voces amigables que no saben de seguros mas que lo que leen en la pantalla. Estas tienen muchos telefonistas (peor pagados que los profesionales que saben lo que hacen) y pocos profesionales. Te atienden al telefono muy bien, pero el trabajo de la compañia lo hacen entre unos pocos, al ritmo que pueden...

    Lo de que el servicio a traves del telefono es bueno no se lo puede creer nadie porque todos tenemos un movil, un adsl, etc... y hemos usado los "estupendos" servicios de cualquier callcenter.

    Para quien le valga ese servicio ahi estan linea directa, MM, ClickS, DirectS, etc... Esta claro que tienen su publico...

    image

    La que te atiende es una teleoperadora, si; pero el que perita tu coche probablemente sea la misma persona que perita otra compañía de esas de oficina y tío trajeado.
  • AfdAAfdA Forero Senior ✭✭✭
    Anakin Skywalker escribió :
    La que te atiende es una teleoperadora, si; pero el que perita tu coche probablemente sea la misma persona que perita otra compañía de esas de oficina y tío trajeado.

    Y...?

    La diferencia es que si el perito, independiente, se equivoca uno se las tiene que ver con una teleoperadora que solo sabe leer lo que le pone la pantallita, y otros tienen un experto en peritaciones que tiene el telefono de quien tiene que solucionar el error...

    image
  • AjperezAjperez Forero Senior ✭✭✭
    quiere que te cuente el cuento de la buena pipa image
  • alfalfaromeoalfalfaromeo MegaForero ✭✭✭
    xantias escribió :
    Pues perdona Javier.net por haber generalizado contigo, pero como no es la primera vez que un asegurado de MMA me responde así... con el consiguiente encabronamiento por mi parte.

    Por supuesto que los daños que tú causes a un contrario están cubiertos y entiendo que la gente busque su propio benificio al contratar un seguro, faltaría mas, pero lo que a mi me encabrona es cuando un siniestro lo tienen que pagar sin ninguna duda y te dan vueltas y más vueltas, intentan ofrecer menos de lo que deben al perjudicado para ver si cuela y al final o tragan o se ven obligados a ir al Juzgado tardando meses en cobrar (para algunos tener que adelantar la indemnizacion es una auténtica faena). Yo, como profesional intento defender a mi asegurado, como es lógico y me pongo en contacto con el asegurado de MMA para que interceda ante su compañía y este te contesta que no es su problema, jode bastante.

    La gente no tiene porque saber si su compañía paga bien o mal, pero si se da el caso de tener un golpe y ver que la compañía no responde, ****, que se impliquen un poco en el asunto, solo pido eso, nada más.

    Un saludo, Javier.

    Estoy totalmente de acuerdo en q MMA realiza esas practicas... aunq no es menos cierto q la mayoria de las aseguradoras intentan escaquearse.

    Por la experiencia q tengo reclamando daños, rara es la compañía q acepta de primeras, intentando normalmente apurar hasta el día antes del juicio para llegar a un acuerdo.

    Tb es cierto q a mi MMA me salía mas barata q mi actual compañía y ni me plantee asegurarme en ella. Mi padre lleva mas de 30 años en ella sin ningun problema, pero mi hermano en 4 años ya ha estado sin coche mas de medio año y yo q he tenido q llevarle las gestiones se lo q es pelear con ellos...

    Para mi el trato personal tiene un precio, desde luego no de 1.000 euros al año, pero si prefiero pagar 100 euros mas y hacerlo con mi agente q se me va a solucionar todo lo q este en sus manos.
  • AjperezAjperez Forero Senior ✭✭✭
    alfalfaromeo escribió :
    Estoy totalmente de acuerdo en q MMA realiza esas practicas... aunq no es menos cierto q la mayoria de las aseguradoras intentan escaquearse.

    Por la experiencia q tengo reclamando daños, rara es la compañía q acepta de primeras, intentando normalmente apurar hasta el día antes del juicio para llegar a un acuerdo.

    Tb es cierto q a mi MMA me salía mas barata q mi actual compañía y ni me plantee asegurarme en ella. Mi padre lleva mas de 30 años en ella sin ningun problema, pero mi hermano en 4 años ya ha estado sin coche mas de medio año y yo q he tenido q llevarle las gestiones se lo q es pelear con ellos...

    Para mi el trato personal tiene un precio, desde luego no de 1.000 euros al año, pero si prefiero pagar 100 euros mas y hacerlo con mi agente q se me va a solucionar todo lo q este en sus manos.



    100 y hasta 300 daria yo, pero donde esta eso?
  • AfdAAfdA Forero Senior ✭✭✭
    Ajperez escribió :
    [/b]


    100 y hasta 300 daria yo, pero donde esta eso?

    Hombre... pues pidiendo precio a un fulano que se anuncia en un foro no creo que lo encuentres... Pero si visitas las corredurias y agencias de tu zona te puedes sorprender. (siempre y cuando tu perfil como conductor sea "normal")

    image
  • AjperezAjperez Forero Senior ✭✭✭
    AfdA escribió :
    Hombre... pues pidiendo precio a un fulano que se anuncia en un foro no creo que lo encuentres... Pero si visitas las corredurias y agencias de tu zona te puedes sorprender. (siempre y cuando tu perfil como conductor sea "normal")

    image



    guguauguauguauauaaaaaa

    acaso crees que no eh preguntado en las oficinas de mapfre, vitalicio y estrella entre otosss image
  • AfdAAfdA Forero Senior ✭✭✭
    Ajperez escribió :
    guguauguauguauauaaaaaa

    acaso crees que no eh preguntado en las oficinas de mapfre, vitalicio y estrella entre otosss image

    Ya... he dicho corredurias y agencias, no oficinas de compañia.

    Los profesionales venden mas barato que la compañia ;)

    image
  • CASIMIRO07CASIMIRO07 Forero Junior
    Click seguros

    Hola buenas yo actualmente tengo el seguro con Click llevo dos años y estoy muy contento.A todo riesgo con franquicia 150€ pago 384€ un Peugeot 307.
    He tenido dos partes uno en un viaje que se me rompio el tubo de escape y como el taller no tenia la pieza, me pusieron un taxi cuatro dias hasta que me lo repararon.
    El segundo sinietro ha sido hace dos meses que le di a una columna del garaje y Click pago la reparacion sin problema y me puso un coche de sustitucion durante cinco dias, para que algunos puedan decir que nadie da duros a cuatro pesetas.
    Antes pagaba en Seguros Bilbao 1000€ con franquicia de 300 y la maxima bonificacion.
  • ellasconducenellasconducen Forero Junior
    Información buena

    Hola,

    Yo hace poco tuve un problema similar con relación al seguro de mi coche y por casualidad encontré esta web donde vi información interesante que me ayudó. Mira a ver, igual te sacan de dudas...

    es esta: http://www.ellasconducen.com/seguro.asp

    ya me dirás que tal
  • bartolomebartolome Forero ✭✭
    Hay que tener en cuenta que el que te hace el seguro es un comercial, no el que luego te va a atender. Yo siempre estuve con Mutua Madrileña luego por el precio me pasé a Direct Seguros, y, sinceramente, no he notado peor servicio las pocas veces que los he necesitado (tampoco ha sido nunca nada grave)
  • ibilisibilis Forero Junior
    Hola,ami también me procupa la diferencia de precio, yo antes estaba con Genesis y pagaba 450 euros y con clik seguros voy (y digo voy por que me voy a pasar ahora) pagaré 323 euros, tengo un 55 de bonificación , mas de 10 años de carnet,asi que me voy a arriesgar,ya os contaré....DESEADME SUERTE....UN SALUDO
  • PAPINPAPIN MegaForero ✭✭✭
    Tengo que renovar en febrero el seguro del Golf y ando afectado por la crisis, así que ya sabeis. Actualmente pago 386 € en Allianz con el gestor de toda la vida y sólo me cubre lunas pero mirando en arpem me sale 247 € más **** + incendio en Direct AXA. Tiene 10 años y 150.000 Km, está en perfecto estado pese a ello.

    http://seguros-coche.arpem.com/resultados.aspx?id=le4t2q55dfizzr45auu1kiqw

    ¿qué os parece? ¿cuál pillariais?
    Estoy muy interesado.

    Saludos.


    quijorna escribió : »
    Buenos días a todos, tengo una seria duda, a ver si alguno me sabéis decir donde está el truco.
    Voy a asegurar un Audi A4 Avant Sline, total 31300€, he pedido presupuesto de seguro a todo riesgo en mi actual compañía que es Mutua Madrileña automovilistica y con la bonificación al máximo me sale a pagar 1280 €/año. He pedido otros presupuestos de pólizas a todo riesgo sin franquicia y esto es más o menos lo que sale:
    Direct Seguros = 700€
    Regal = 879€
    Linea Directa = 900€
    Fenix Directo = 1000€
    Genésis = 794 €
    Reale Seguros = 1000€
    Y la que me voy a pillar, pero que me ha extrañado mucho es Click Seguros = 438€. ¿Como puede ser esto?, porque entiendo diferencias de 100 o 200€, ¿pero de 800€?.
    Alguno tenéis Click seguros?, Habéis tenido que hacer uso de la póliza?, Funcionan bien?, Cual es el truco?



    Bueno para más info, tengo 30 años, 10 de carnet y bonificación actual en mi compañía al máximo.

    Gracias y saludos.
    ¿Buscas un Nissan?
    Disponemos de más de 100 vehículos en stock.
    esuzeataoal2.jpg
  • lord_willlord_will Forero Senior ✭✭✭
    Psicologia del consumidor

    Va a un supermercado y se encuentra tres productos basicos, tremendamente genericos y casi indiferenciados. El primero es el mas caro, el segundo el mas economico y el tercero esta en un termino medio de precios.

    Para hacerlo facil; Pensemos que ese producto es un antical para la lavadora.

    Dialogo interno del consumidor.

    - Pssss. A mi estos no me la cuelan! Que yo soy muy listo! jajaja (Refiriendose al caro).

    - Bah. Yo soy un tio de classe media-alta y no voy a ser tan CUTRE como para comprar el mas barato. Y ademas que hace como de probre. Buff, por Dios! quita, quita. (refiriendose al economico)

    - Este es el mio. Debe tener la mejor relacion calidad/precio porque tiene un precio medio. Si es que soy un crack! Con este voy a triumfar. Por que yo lo valgo. (Refiriendose al de precio medio).

    Volvamos a pensar en el antical. ¿De verdad os creeis que cualquier niñato con media carrera de Quimica, medio pedo de cervezas y hierba no sabria hacer una pastilla identica a la de la marca premium antical en el laboratorio de la universidad mas cutre de Polonia?

    La realidad resulta que si varios productos son extremadamente parecidos, poco o nada diferenciados, con los mismos atributos o cualidades, etc... Coge el barato ****!!.

    Moraleja. Si las diferencias entre ambos seguros no son SUSTANCIALES, coge el barato. Y con sustanciales me refiero a que el caro (recuerda; el triple de caro) venga a tu casa una vez al dia para limpiarte el culo con billetes de 500€ y luego que ponga polvitos talcos y una locion Johonson&Johonson.

    Saludos.
  • jorudujorudu Forero Junior
    Agentes de seguros vs compañías
    xantias escribió : »
    Totalmente de acuerdo.

    El día que tengan un siniestro que se escape de la normalidad, a ver como se lo explican a la telefonista de turno. image

    Contratar un seguro con un profesional, significa que vas a tener a alguien independiente que defienda tus intereses frente a la Compañía. Como comprenderéis, los empleados no son precisamente imparciales, defienden a la empresa que les paga.

    No obstante, hay Compañías que se gastan mucho dinero en mantener oficinas abiertas en todo el territorio, con sus respectivos empleados formados que no necesitan tener a mano un guión para poder resolver un siniestro, y eso hay que pagarlo.

    Cuando me compre un coche, lo voy a comprar por internet, y cuando tenga una avería, llamo al telefonista mecánico para que me indique como repararlo, seguro que me sale más barato.


    Ya sé que este es mi primer mensaje, y no es buena forma de comenzar.
    Ya sé que estas entradas tienen tiempo, y no tiene mucho sentido responder ahora, pero ahora que se ha reactivado el hilo, no lo puedo evitar:

    Agentes y corredores hacen una función importantísima en el sector de seguros, pero me parece de muy mal gusto que hablen mal de compañías, que són junto con los clientes (ellos dicen que son suyos, pero el cliente no es de nadie) son los que le dan de comer. Sin compañías, los agentes, corredores y mediadores venderían humo, serían expertos en unas leyes (y no todos) -Ley del Seguro y Ley de la Mediación- pero ya está....Y si quiero un experto en leyes, busco un abogado que es experto en todo, y él sí que me va a representar siempre. Tengo muy buenos amigos agentes de seguros, gente formal y seria, pero que no se dedica a hablar mal de los demás. Son expertos que recomiendan a clientes qué hacer, negocian con compañías riesgos extraños (como para industrias, comercios, etc) pero para autos, no es necesario un mediador o agente. Si un cliente busca y compara, junto con las opiniones de foreros, puede seleccionar una compañía con una buena relación calidad/precio. Algunos agentes se mueven por intereses personales (si cambio a este cliente este año gano más que la comisión que me dan por mantenerlo...), por suerte son algunos,...y los que trabajan para una sola compañía, es exactamente lo mismo que el trabajador de una compañía, con la diferencia que ellos no trabajan en la compañía.

    Y sí, trabajo en una compañía de seguros,...acepto que para los clientes seamos los malos, si se analiza se paga un dinero anual por si me pasa algo, y si no pasa nada, lo veo como dinero perdido,...vale, yo también soy cliente. Pero esta actitud de intermediarios, normalmente interesada, me parece poco profesional.

    Si me responde alguno de los críticos, les digo realmente como están formados los "telefonistas"...

    Perdonad el rollo, creo que no he empezado bien,...
  • jorudujorudu Forero Junior
    Cuando sepas de lo que hables, habla, pero si no, calla
    AfdA escribió : »
    De acuerdo en el hecho de la oficina en si. Pero es que la diferencia no es esa.

    Unos ladrillos no te sirven, estamos de acuerdo.

    Pero lo que hay dentro si.

    En una compañia tradicional, con oficinas, sucursales y mediadores, las oficinas no estan vacias. Hay profesionales. Muchos. A los que las compañias les pagan (empleados) porque realizan un trabajo, que si no fuera imprescindible, te garantizo, no les pagarian.

    Sin embargo, la compañia sin oficinas lo que tiene es un call center lleno de voces amigables que no saben de seguros mas que lo que leen en la pantalla. Estas tienen muchos telefonistas (peor pagados que los profesionales que saben lo que hacen) y pocos profesionales. Te atienden al telefono muy bien, pero el trabajo de la compañia lo hacen entre unos pocos, al ritmo que pueden...

    Lo de que el servicio a traves del telefono es bueno no se lo puede creer nadie porque todos tenemos un movil, un adsl, etc... y hemos usado los "estupendos" servicios de cualquier callcenter.

    Para quien le valga ese servicio ahi estan linea directa, MM, ClickS, DirectS, etc... Esta claro que tienen su publico...

    image

    Me sorprendo muchísimo contigo, no tienes ni idea de como funciona una compañía de seguros, ni de las tradicionales, ni las de directo (telefónicas es absurdo, todas tienen teléfono y call centers,..).

    ¿No ves que estás dejando mal al resto de agentes hablando de esta forma?

    Efectivamente, las compañías de directo tienen su público, pero algo harán bien si resulta que las tradicionales empiezan a "copiar" estrategias como tener tarificadores online, o aparecer en comparadores de seguros como ARPEM, ASESOR SEGUROS, RASTREATOR (y las que vienen). Lo que te j... es que haya gente que no te necesite, y que se pueda buscar la vida sin que te lleves comisión,...lo siento pero acostúmbrate!!

    Si quieres hablar de seguros, aquí estoy, pero no intentes liar a la gente del foro. Se te ve el plumero.

    Y por cierto, si alguien tiene alguna duda de qué hacer con alguna compañía, aquí estoy. Nunca os diré en qué compañía trabajo, no tengo ningún interés, pero sí os puedo ayudar con la compañía que sea dando consejos siempre que se quieran, claro.

    Siento aportar poco, y encima dar caña, así que me resarciré ayudando a aquellos que tengan dudas al respecto de seguros.

    Saludos

Deja un comentario

NegritaCursivaTacharOrdered listLista sin ordenar
Emoticonos
Imagen
Alinear a la izquierdaCentrarAlinear a la derechaEnciende/apaga vista HTMLActivar/desactivar la página enteraEncender/apagar las luces
Sube imagen o archivo